locus

name
ccmp10
chromosome
not available
UniSTS code
not available
GenBank code
not available
alleleSizeMin
91
alleleSizeMax
300
order priority
-1.0
pdf
not available
primer forward
name
ccmp10 [F]
sequence
tttttttttagtgaacgtgtca
annealing temperature
50.0
length in bases
22
primer reverse
name
ccmp10 [R]
sequence
ttcgtcgdcgtagtaaatag
annealing temperature
50.0
length in bases
20
updated at
2007-09-12 09:14:09.527359