locus

name
ccmp7
chromosome
not available
UniSTS code
not available
GenBank code
not available
alleleSizeMin
129
alleleSizeMax
151
order priority
-1.0
pdf
not available
primer forward
name
ccmp7 [F]
sequence
caacatataccactgtcaag
annealing temperature
50.0
length in bases
20
primer reverse
name
ccmp7 [R]
sequence
acatcattattgtatactctttc
annealing temperature
50.0
length in bases
23
updated at
2007-09-12 09:14:09.527359